StructureChemical NameCASMF
ACACIAAURICULIFORMIS
ACACIADEALBATAEXTRACT
ACACIADEALBATALEAFWAX
ACACIABAILEYANAGUM
ACACIALEAVES
ACACIAMELANOXYLONWOOD
ACACIAAURICULIFORMISBARK,CHLOROFORMEXTRACT
ACACIAPYCNANTHAGUM
ACACIACONCINNAEXTRACT
ACACIPETALIN 644-68-8 C11H17NO6
AASVTLTVQARLLLS C68H123N19O21
2,2-AC-ADAMANTANE C14H20O2
ACAD8 (Acyl-Coenzyme A Dehydrogenase 8, Mitochondrial) Recombinant, Human
Ac-γAbu-L-Glu-OH
ACAD8, CT (Acyl-Coenzyme A Dehydrogenase 8, Mitochondrial)
ACAD8 (full length)
AC-A(D-ISOGLN)K(AC)(D-ALA)-OH C18H31N5O7
ACAD8, NT (Acyl-Coenzyme A Dehydrogenase 8)
AC-AEEEYA-AMIDE C32H45N7O14
AC-AEERA-AMIDE C24H41N9O10
A.CAESPITOSUS
AC AGAR
AC-AEVD-CHO C19H30N4O9
AC-AEVD-AFC C29H34F3N5O11
ACA FLUORESCEIN LABELED
ACA4 gene product
ACA 22 gel 71567-47-0
AATP2 protein
AATP1 protein
ACAGGCGCCTGT, 5'-NON-PHOSPHORYLATED
5' ACAGGAAACAGCTATGACCTTG 3'
ACAGGCGCCTGT, 5'-PHOSPHORYLATED
A,A,4-TRIMETHYLBENZYLCARBANILATE C17H18NO2-
A,A,2-TRIMETHYLBENZYLALCOHOL C10H14O
11A,17A,21-TRIHYDROXY-1,4-PREGNADIEN-3,20-DION C21H28O5
ABL C62H100N14O23
2,4A,8A-TRIMETHYLTETRADECAHYDRO-2-PHENANTHRYLMETHYLP-TOLUENESULFONATE
A,A,3-TRIMETHYLBENZYLALCOHOL C10H14O
(2A,3A)-2,3,5-TRIHYDROXY-7-METHOXY-2-METHYLANTHRAQUINONE5-(P-BROMOBENZOATE) C23H17BrO8
2A,3A,24-TRIHYDROXY-12-URSEN-28-OIC ACID C30H48O5
Aau I
3a,8,10a-Trihydroxy-5-(hydroxymethyl)-2,10-dimethyl-4,6a,7,8,9,10,10a, 10b-octahydrobenzo[e]azulen-3(3ah)-one 77573-30-9 C17H24O5
14 A,17 A,21-TRIHYDROXY-4-PREGNENE-3,20-DIONE C21H30O5
(4aβ,8aα)-4,4,7-Trimethylhexahydro-4H-1,3-benzoxathiin
(3aα,7aβ)-2-[(Triphenylgermyl)methyl]octahydro-1H-inden-1-one
4a,6,9a-Trimethyl-1,2,3,4,4a,9a-hexahydro-9H-pyrido[2,3-b]indole
4a,9,9a-Trimethyl-1,2,3,4,4a,9a-hexahydro-9H-pyrido[2,3-b]indole
3,3a,8a-Trimethyl-1,2,3,8-tetrahydropyrrolo[2,3-b]indole
(4aα,8aβ)-2-[(Triphenylgermyl)methyl]decalin-1-one
(3aβ,6aβ)-4β-(Trityloxymethyl)-5α-(benzoyloxy)hexahydro-2H-cyclopenta[b]furan-2-one
(3aα)-4,4,5aβ-Trimethyl-8α-methoxydecahydrocyclopenta[c]pentalene-1β-carbaldehyde
3a,7,8a-Trimethyl-1,2,3,8-tetrahydropyrrolo[2,3-b]indole
Acai Berry Extract
Acai,EuterpeOleracea
5' AATTAACCCTCACTAAAGGG 3'
ACAI OIL EUTERPE OLERACEA PULP OIL 861902-11-6
ACAI POWDER EXTRACT
Abl, active, Recombinant, Murine
AC-ALA-GLU-OH 57282-74-3 C10H16N2O6
AC-ALA-NH2 15962-47-7 C5H10N2O2
AC-ALA-ALA-PRO-ALA-BETANA 102029-65-2 C26H33N5O5
AC-ALA-GLU-TYR-TYR-ASN-LYS-GLN-TYR-LEU-GLU-GLN-THR-ARG-ALA-GLU-LEU-ASP-THR-NH2 157505-54-9 C100H150N26O35
Ac-Ala-Ala-Ser(PO3H2)-Pro-Arg-pNA 202739-37-5 C28H43N10O12P
AC-ALA-GLN-ALA-PNA 201677-60-3 C19H29N7O7
AC-ALA-GLU-VAL-ASP-PARANITROANILIDE C25H34N6O11
AC-ALA-ALA-PRO-PHE-PNA 70967-94-1 C28H34N6O7
AC-ALA-GLN-VAL-ASP-PARANITROANILIDE C25H35N7O10
AC-ALA-OME 3619-02-1 C6H11NO3
AC-ALA-TRP-OH C16H19N3O4
AC-ALA-GLN-OH 121574-43-4 C10H17N3O5
AC-ALA-AMC 355137-87-0 C15H16N2O4
AC-ALA-ALPHA-NAPHTHYL ESTER 69975-68-4 C15H15NO3
AC-ALA-LEU-CYS-ASP-ASP-PRO-ARG-VAL-ASP-ARG-TRP-TYR-CYS-GLN-PHE-VAL-GLU-GLY-NH2 C97H141N27O29S2
AC-ALA-ALA-TYR-AMC 99590-93-9 C27H32N4O6
AC-ALA-SER-GLN-ALA-ARG-PRO-SER-GLN-ARG-HIS-GLY-OH C49H81N21O17
AC-ALA-ALA-LYS-7-AMINO-4-TRIFLUORO-METHYLCOUMARIN C24H30F3N5O6
AC-ALA-SER-GLN-LYS-ARG-PRO-SER-GLN-ARG-HIS-GLY-OH 106128-98-7 C52H88N22O17
AC-ALA-ALA-ALA-PNA 40817-33-2 C17H23N5O6
AC-ALA-ALA-ALA-ALA-OH 15483-58-6 C14H24N4O6
AC-ALA-ALA-PHE-OME 50395-42-1 C18H25N3O5
AC-ALA-ALA-PRO-VAL-PNA 133261-53-7 C24H34N6O7
AC-ALA-THR-LEU-ASP-ALA-LEU-LEU-ALA-ALA-LEU-ARG-ARG-ILE-GLN-NH2 197230-90-3 C69H124N22O19
Ac-βAla-L-Asp-OH
Ac-βAla-L-Glu-OH
AC-ALA-NHME 19701-83-8 C6H12N2O2
AC-ALA-PNA 35978-75-7 C11H13N3O4
AC-ALA-SER-THR-ASP-AMC 354151-60-3 C26H33N5O11
AC-ALA-SER-GLN-TYR-ARG-PRO-SER-GLN-ARG-HIS-GLY-OH C55H85N21O18
AC-ALA-ALA-LYS-4-METHOXY-2-NAPHTHYLAMINE C25H35N5O5
AC-ALA-SER-GLN-LYS-ARG-PRO-SER-GLN-ARG-SER-LYS-OH C53H95N21O18
AC-ALA-GLU-VAL-ASP-7-AMINO-4-METHYLCOUMARIN C29H37N5O11
Ac-β-Ala-OH.DCHA C5H9NO3·C12H23N
AC-ALA-ALA-PRO-ALA-AMC 62037-45-0 C26H33N5O7
AC-ALA-THR-GLN-ARG-LEU-ALA-ASN-PHE-LEU-VAL-ARG-SER-SER-ASN-ASN-LEU-GLY-PRO-VAL-LEU-PRO-PRO-THR-ASN-VAL-GLY-SER-ASN-THR-TYR-NH2 C142H229N43O44
2-Acetylaminopropionic acid 97-69-8 C5H9NO3
AC-ALA-ALA-OME 30802-26-7 C9H16N2O4
AC-ALA-ALA-OH 19245-87-5 C8H14N2O4
AC-ALA-PRO-ALA-PNA 61596-39-2 C19H25N5O6
AC-ALA-ASP-LYS-PRO-ASP-MET-GLY-GLU-ILE-ALA-SER-PHE-ASP-LYS-ALA-LYS-LEU-LYS-LYS-THR-GLU-THR-GLN-GLU-LYS-ASN-THR-LEU-PRO-THR-LYS-GLU-THR-ILE-GLU-GLN-GLU-LYS-ARG-SER-GLU-ILE-SER-OH
AC-ALA-ALA-LYS-7-AMINO-4-METHYLCOUMARIN C24H33N5O6
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127